Perkinelmer Nova-5149-21 Nextflex Rapid Xp V2 Dna Seq Kit Instruction Manual

Perkinelmer Nova-5149-21 Nextflex Rapid Xp V2 Dna Seq Kit Instruction Manual

PerkinElmer NOVA-5149-21 Nextflex Rapid XP V2 DNA Seq kit Instruction Manual
PerkinElmer NOVA-5149-21 Nextflex Rapid XP V2 DNA Seq kit

This product is for research use only.
Not for use in diagnostic procedures.

This manual is proprietary to PerkinElmer and intended only for customer use in connection with the product(s) described herein and for no other purpose.

This document and its contents shall not be used or distributed for any other purpose without the prior written consent of PerkinElmer. Follow the protocol included with the kit.

PerkinElmer, NEXTflex, NextPrep, NextPrep-Mag, AIR, The NGS Experts, qRNA, Amplicon Studio, and NanoQ are trademarks or registered trademarks of PerkinElmer. All other brands and names contained herein are the property of their respective owners.

Product Overview

The NEXTFLEX® Rapid XP V2 DNA-Seq kit is designed for ~4 hours library construction and pooling from 100 pg – 1 µg of DNA. The kit can be used to prepare single, paired-end, and multiplexed DNA libraries for sequencing using Illumina® platforms. The NEXTFLEX® 1-step Fragmentation, End-Repair, and Adenylation simplifies workflow and shortens hands-on library construction time. In addition, the availability of up to 1,536 different Unique Dual Index adapter barcodes facilitates high-throughput applications.

There are three main steps involved in preparing DNA for sequencing: DNA fragmentation/end repair/ adenylation, adapter ligation, and post-adapter ligation PCR amplification. The NEXTFLEX® Rapid XP V2 DNA-Seq kit contains the necessary material to take the user’s extracted nucleic acid sample through preparation and amplification for loading onto flow cells for sequencing

Kit Contents, Storage & Shelf Life

The NEXTFLEX® Rapid XP V2 DNA-Seq kit contains enough material to prepare 8, 48 or 96 samples for Illumina® sequencing. The shelf-life of all reagents is at least 6 months when stored properly. The  Nuclease-free Water and, Elution Buffer can be stored at room temperature. The NEXTFLEX® Cleanup Beads XP and NEXTFLEX® Normalization Beads V2 should be stored at 4°C, and all other components should be stored at -20°C.

Kit Contents8 rxn48 rxn96 rxn
NEXTFLEX® Fragmentation Buffer V240 μL240 μL480 μL
NEXTFLEX® Fragmentation Enzyme V220 μL120 μL240 μL
NEXTFLEX® Ligation Master Mix V280 μL480 μL960 μL
NEXTFLEX® PCR Master Mix V2100 μL600 μL1.2 mL
NEXTFLEX® Primer Mix V220 μL120 μL240 μL
Nuclease-free Water1.5 mL(2) 1.5 mL6 mL
Elution Buffer184 μL1.104 mL2.208 mL
NEXTFLEX® Cleanup Beads XP1 mL3 mL5 mL
NEXTFLEX® Normalization Beads V2872 μL5.3 mL11 mL

Required Materials Not Provided

  • 100 pg – 1 µg of DNA in up to 17.5 µL nuclease-free water
  • If multiplexing: NEXTFLEX® DNA Barcodes – 6 / 12 / 24 / 48 (Cat # 514101, 514102, 514103, 514104) or NEXTFLEX-96™ DNA Barcodes (Cat # 514106) or NEXTFLEX HT™ Barcodes (Cat # 514174, 514175, 514176, 514177) or NEXFLEX® Unique Dual Index Barcodes (Cat # 514150, 514151, 514152, 514153) or 1,536 NEXFLEX® Unique Dual Index Barcodes (Cat # 534100)
  • Ethanol 100% (room temperature)
  • 96 well PCR Plate Non-skirted (Phenix Research, Cat # MPS-499) or similar
  • Adhesive PCR Plate Seal (BioRad, Cat # MSB1001)
  • Magnetic Stand -96 (Thermo Fisher Scientific, Cat # AM10027) or similar
  • Thermal Cycler
  • 2, 10, 20, 200 and 1000 µL pipettes / multichannel pipettes
  • Nuclease-free barrier pipette tips
  • Vortex

Warnings and Precautions

We strongly recommend that you read the following warnings and precautions. Periodically, optimizations and revisions are made to the components and manual. Therefore, it is important to follow the protocol included with the kit. If you need further assistance, contact us at [email protected].

  • Do not use the kit past the expiration date.
  • Ensure pipettes are properly calibrated as library preparations are highly sensitive to pipetting error.
  • Do not remove enzymes from -20ºC until immediately before use; return to -20ºC immediately after use.
  • This kit does not contain Barcoded Adapter. To enable multiplexing, please use the appropriate concentration of the NEXTFLEX® barcoded adapters during the Adapter Ligation step.
  • Do not freeze NEXTFLEX® Cleanup Beads XP or NEXTFLEX® Normalization Beads V2.
  • Vortex beads until they are a uniform suspension.
  • Thermal cycling should be performed with a heated lid (103ºC-105ºC) except where specified.
  • Maintain a laboratory temperature of 20º–25ºC (68º–77ºF).
  • DNA sample quality may vary between preparations. It is the user’s responsibility to utilize high quality DNA. DNA that is heavily nicked or damaged may cause library preparation failure. Absorbance measurements at 260 nm are commonly used to quantify DNA and 260 nm / 280 nm ratios of 1.8 – 2.0 usually indicate relatively pure DNA. The user should be aware that contaminating RNA, nucleotides and single-stranded DNA may affect the amount of usable DNA in a sample preparation.
  • Presence of EDTA in starting input DNA can alter final library size. For optimal results, input DNA should be resuspended in ultrapure water or low TE buffer.

Revision History

VersionDateDescription
V22.06June 2022Product Launch

Figure 1. Sample flow chart showing the different steps of the protocol.
Sample flow chart

Starting Material

The NEXTFLEX® Rapid XP V2 DNA-Seq kit has been optimized and validated using high quality genomic DNA inputs ranging from 100 pg – 1 µg.

Reagent Preparation

  1. Briefly spin down each component to ensure material has not lodged in the cap or side of tube. Keep on ice and vortex each NEXTFLEX® component except the NEXTFLEX® Fragmentation Enzyme Mix just prior to use. Nuclease-free Water and Elution Buffer should be stored at room temperature. NEXTFLEX® Cleanup Beads XP and NEXTFLEX® Normalization Beads V2 should be stored at 4°C but equilibrated to room temperature prior to use.
  2. DTT in buffers may precipitate after freezing. If precipitate is seen, vortex buffer for 1-2 minutes or until the precipitate is in solution. The performance of the buffer is not affected once the precipitate is in solution.
  3. The 80% ethanol for bead washing steps should be freshly made prior to use.
  4. Allow NEXTFLEX® Cleanup Beads XP to come to room temperature and vortex the beads until homogenous.
  5. NEXTFLEX® Normalization Beads V2 preparation.
    NOTE: NEXTFLEX® Normalization Beads V2 should be made for immediate use. Once 100% EtOH has been added to NEXTFLEX® Normalization Beads V2, they should be used within 2 weeks.

STEP A: Fragmentation, End-repair & Adenylation

MATERIALS

  • NEXTFLEX® Fragmentation Buffer V2
  • NEXTFLEX® Fragmentation Enzyme V2

User Supplied

  • DNA in 17.5 μL (or less) nuclease-free water
  • Thermal Cycler
  • 96 well PCR Plate
  • Adhesive PCR Plate Seal
  • Micro centrifuge
  1. Set the thermocycler to 4°C paused while performing the following steps
  2. For each sample, combine the following reagents in a nuclease-free 96 well PCR plate:
    _ µLNuclease-free water
    _ µLDNA (100 pg – 1 μg)
    5 µLNEXTFLEX® Fragmentation Buffer V2
    22.5 µLTOTAL
  3. Transfer plate to thermal cycler at 4°C (paused).
  4. Leave plate for 30 seconds in thermal cycler at 4°C.
  5. Add 2.5 μL of NEXTFLEX® Fragmentation Enzyme V2, pipette 10 times with pipette set to 17.5 μL

NOTE: Do NOT vortex the final NEXTFLEX® Fragmentation reaction. Mix by pipette only.
Apply adhesive PCR plate seal and incubate on a thermal cycler using the following program:

1 min4°C
See fragmentation table35°C
30 min65°C
hold4°C

The following table lists the recommended incubation times as a guideline for fragmentation.

The mode fragment size can be adjusted by changing the duration of incubation at this 35 °C step. These times are recommendations only, and incubation time may need to be optimized for different sample inputs and types to obtain desired mode fragment size.

Input DNA (ng)Fragmentation Time (min) at 35°C
0.1-9910
100-1,00025

NOTE: The final library size will be approximately 120 bp larger than the fragment size. 6. Proceed immediately to Step B

STEP B: Adapter Ligation

MATERIALS

  • NEXTFLEX® Ligation Master Mix V2
  • NEXTFLEX® Cleanup Beads XP
  • NEXTFLEX® Unique Dual Index Barcodes Plate
  • Nuclease-free Water

User Supplied

  • 25 μL of Fragmented, End Repaired, and Adenylated DNA (from STEP A)
  • Thermal Cycler
  • Adhesive PCR Plate Seal
  • 80% Ethanol, freshly prepared (room temperature)
  • Magnetic Stand

Adapter Ligation

  1. Invert the Ligation Master Mix 5 times to homogenize (DO NOT VORTEX) and place on ice.
  2. Each sample will require 2.5 μL of barcoded adapter to be added. Combine the following in the PCR plate and mix thoroughly by pipette:
    For starting input <1ng, dilute NEXTFLEX® Barcoded Adapter 1:10 with ultrapure water.
    25 µLFragmented, End Repaired & Adenylated DNA (from Step A)
    10 µLNEXTFLEX® Ligation Master Mix V2
    2.5 µLNEXTFLEX® Barcoded Adapter*
    37.5 µLTOTAL

    Adapter should not be premixed to prevent excess adapter dimer formation.

  3. Apply adhesive PCR plate seal and run the following program on a thermal cycler with heated lid turned off or open:
    30 min20°C
    hold4°C

Post-Ligation Clean-up

  1. Remove plate from thermal cycler.
  2. Add 30 μL of NEXTFLEX® Cleanup Beads XP to the 37.5 μL of Adapter Ligated DNA.
  3. Incubate at room temperature for 5 minutes.
  4. Place the 96 well PCR plate on the magnetic stand at room temperature for 2 minutes or until the supernatant appears completely clear.
  5. Remove and discard clear supernatant taking care not to disturb beads. Some liquid may remain in well.
  6. With the plate on the stand, add 200 μL of 80% ethanol to each magnetic bead pellet and incubate plate at room temperature for 30 seconds. Carefully remove ethanol by pipette.
  7. Repeat previous step for a total of 2 ethanol washes. Ensure all ethanol has been removed.
  8. With the plate on the magnetic stand, let beads air dry at room temperature for 3 minutes.
    Do not over dry beads or yield may suffer.
  9. Resuspend dried beads with 12 μL of water. Mix thoroughly until homogenized.
  10. Incubate sample at room temperature for 2 minutes.
  11. Place the 96 well PCR plate on the magnetic stand at room temperature for 2 minutes or until the supernatant appears completely clear.
  12. Do not discard the sample in this step. Transfer 10 μL of clear sample to a new well.
    Remove the 96 well PCR plate from the magnetic stand.
  13. Proceed immediately to Step C.

STEP C: Post-Ligation PCR

MATERIALS

  • NEXTFLEX® PCR Master Mix V2
  • NEXTFLEX® Primer Mix V2

User Supplied

  • 10 μL of Adapter Ligated DNA (from STEP B)
  • Thermal Cycler
  • Adhesive PCR Plate Seal
  • 96 Well PCR Plate
  • 80% Ethanol, freshly prepared (room temperature)
  • Magnetic Stand
    Thaw NEXTFLEX® PCR Master Mix V2 on ice. Once thawed invert several times or swirl to vigorously mix (DO NOT VORTEX).
  1. For each sample, combine the following reagents on ice in the PCR plate. Mix thoroughly.
    10 μLAdapter Ligated DNA (from Step B)
    12.5 μLNEXTFLEX® PCR Master Mix V2*
    2.5 μLNEXTFLEX® Primer Mix V2*
    25 μLTOTAL

    These components can be premixed and added in a single step.

  2. Apply adhesive PCR plate seal and place in thermal cycler for the following PCR cycles:
    TimeTemperatureCycles
    45 sec 98°C1
    15 sec 98°C 
    30 sec 60°CSee Table
    30 sec 72°C 
    1 min 72°C1
    HOLD 12°C1
    Genomic DNA input (ng)PCR Cycles for bead-based normalization  
    0.114
    0.513
    0.7512
    110
    58
    107
    505
    1004
    5003
    1,0002
  3. Post-PCR, proceed to either Step D Bead-Based Library Normalization OR Step E Clean Up Beads.

STEP D: Bead-Based Library Normalization

MATERIALS

  • NEXTFLEX® Normalization Beads V2
  • Elution Buffer

Reagent Preparation: 100% Ethanol must be added to the NEXTFLEX® Normalization Beads V2 prior to use. Only prepare enough beads for the number of library preparation reactions.

Reagent1x Reaction
  NEXTFLEX® Normalization Beads V2109 µL
100% Ethanol75 µL

User Supplied

  • 25 μL of Amplified Library (STEP C)
  • 100% Ethanol (room temperature)
  • 80% Ethanol, freshly prepared (room temperature)
  • Magnetic Stand
  1. Add 184 μL of NEXTFLEX® Normalization Beads V2 to each well containing supernatant. Mix thoroughly until homogenized.
    Ensure 100% Ethanol has been added to the NEXTFLEX® Normalization Beads V2. (See Reagent Preparation)
  2. Incubate at room temperature for 8 minutes.
  3. Place the 96 well PCR plate on the magnetic stand at room temperature for 5 minutes until the supernatant appears completely clear.
  4. Remove and discard clear supernatant taking care not to disturb beads. Some liquid may remain in wells.
    Supernatant containing non-normalized library can be transferred to a clean tube and frozen. The tube may be thawed and purified for additional recovery.
    Contact [email protected] for assistance.
  5. With plate on stand, add 200 μL of 80% ethanol to each magnetic bead pellet and incubate plate at room temperature for 30 seconds. Carefully remove ethanol by pipette.
  6. Repeat previous step for a total of 2 ethanol washes. Ensure all ethanol has been removed.
    To aid in ethanol removal, use a clean set of p20 multichannel pipette tips, set the p20 volume to 15 μL and carefully remove any residual ethanol from the bottom of the tube.
  7. With plate on magnetic stand, air dry beads at room temperature for 3 minutes.
  8. Resuspend dried beads with 23 μL of Elution Buffer.
  9. Mix thoroughly until homogenized.
  10. Incubate resuspended beads at room temperature for 2 minutes.
  11. Place the 96 well PCR plate on the magnetic stand at room temperature for 2 minutes or until the supernatant appears completely clear.
  12. Do not discard the supernatant in this step. Transfer 20 μL of clear sample to a new well.
  13. Remove the 96 well PCR plate from the magnetic stand and discard.
  14. Pool 5 μL of each eluted sample into single Pooled Library tube (1.5 mL tube).
    Library quantification of pooled material can be performed using fluorometric methods [recommended: Qubit] to determine concentration.
    NOTE: qPCR is recommended to quantify DNA library template for optimal cluster density. This can be performed using any qPCR quantification kit for Illumina platforms and the NEXTFLEX® Primer Mix V2 as needed.
  15. Examine your single pooled library sample by electrophoresis to ensure proper library sizing [recommended: LabChip GX Touch instrument (PerkinElmer)].
    NOTE: Final pooled library size should be close to 425bp. If user does not have
    electrophoresis capabilities, this size may be used.
  16. The library is now ready for cluster generation per the standard Illumina® protocol.
    Proceed to cluster generation or seal with adhesive PCR plate seal and store at – 20 °C.

STEP E: Clean Up Beads

  1. Add 20 μL of NEXTFLEX® Cleanup Beads XP to the 25 μL of PCR amplified libraries.
  2. Incubate at room temperature for 5 minutes.
  3. Place the 96 well PCR plate on the magnetic stand at room temperature for 2 minutes or until the supernatant appears completely clear.
  4. Remove and discard clear supernatant taking care not to disturb beads. Some liquid may remain in well.
  5. With the plate on the stand, add 200 μL of 80% ethanol to each magnetic bead pellet and incubate plate at room temperature for 30 seconds. Carefully remove ethanol by pipette.
  6. Repeat previous step for a total of 2 ethanol washes. Ensure all ethanol has been removed.
  7. With the plate on the magnetic stand, let beads air dry at room temperature for 3 minutes.
    Do not over dry beads or yield may suffer.
  8. Resuspend dried beads with 22 μL of water. Mix thoroughly until homogenized.
  9. Incubate sample at room temperature for 2 minutes.
  10. Place the 96 well PCR plate on the magnetic stand at room temperature for 2 minutes or until the supernatant appears completely clear.
  11. Do not discard the sample in this step. Transfer 20 μL of clear sample to a new well.
    Remove the 96 well PCR plate from the magnetic stand.
    Quantification of each library can be performed using fluorometric methods [recommended: Qubit] to determine concentration.
    NOTE: qPCR is recommended to quantify DNA library template for optimal cluster density. This can be performed using any qPCR quantification kit for Illumina platforms and the NEXTFLEX® Primer Mix as needed.
  12. Examine your libraries by electrophoresis to ensure proper library sizing
    [recommended: LabChip GX Touch instrument (PerkinElmer)].
    NOTE: Library size should be close to 425bp. If user does not have electrophoresis capabilities, this size may be used.
  13. The library is now ready for cluster generation per the standard Illumina® protocol.
    Proceed to cluster generation or seal with adhesive PCR plate seal and store at – 20 °C.

Library Validation

Library Validation

Oligonucleotide Sequences

NEXTFLEX®Sequence (5′-3′)
PCR Primer 1AATGATACGGCGACCACCGAGATCTACAC
PCR Primer 2CAAGCAGAAGACGGCATACGAGAT

INNOVATIVE SAMPLE TO ANSWER GENOMICS WORKFLOWS
PERKINELMER-APPLIEDGENOMICS.COM
LIKE IT. LOVE IT. SHARE IT

APPLIED GENOMICS

APPLIED GENOMICS @PerkinElmer_AG
APPLIED GENOMICS PerkinElmer Applied Genomics

PerkinElmer, Inc.
7050 Burleson Rd | Austin, TX 78744 USA
P: (888) 208-2246 | F: (512) 707-8122
www.perkinelmer-appliedgenomics.com

Copyright ©2022, PerkinElmer, Inc. All rights reserved. PerkinElmer® is a registered trademark of PerkinElmer, Inc. All other trademarks are the property of their respective owners.

PerkinElmer logo

References

Documents / Resouces

Download manual
Here you can download full pdf version of manual, it may contain additional safety instructions, warranty information, FCC rules, etc.


Related Manuals