Omega Oo654x, Oo654wa Built In Electric Oven Instruction Manual (+ PDF)

Contents hide

1 OO654X, OO654WA Built In Electric Oven

OO654X, OO654WA Built In Electric Oven

Product Information

The Omega Built-In Electric Oven (models OO654X and OO654WA) is
a stylish and functional appliance designed to enhance your modern
lifestyle. It combines sleek and sophisticated design with
effortless functionality, making it a perfect addition to any busy
household. Omega appliances are known for their balance between
stunning form and clever function, sourced from the best
craftsmanship and international design houses.

For more information about your Omega Appliance, including
warranty registration, manuals, features, and specifications,
please visit omegaappliances.com.au (for customers in Australia) or
omegaappliances.co.nz (for customers in New Zealand). You can also
contact our Customer Care team via email or phone.

To register your warranty for peace of mind, please visit
omegaappliances.com.au. Additional information about the warranty
can be found at the end of this manual.

Contact our customer service team for any questions or concerns.
We are available Monday to Friday from 9.00am to 5.00pm. You can
reach us by phone at 09 415 6000 or send us an email at your
convenience.

Stay up to date with Omega Appliances and find simple and easy
recipes by following us on our social media accounts:

Facebook: facebook.com/omegaappliances
Instagram: instagram.com/omegaappliances_aus

Product Usage Instructions

Before installing and using the Omega Built-In Electric Oven, it
is crucial to read the instruction booklet provided. Retain these
instructions, proof of purchase, and other important documents for
future reference. The manufacturer will not be responsible for any
damage to property or persons caused by incorrect installation or
improper use of the appliance.

Follow these safety precautions:

This appliance is not intended for use by persons (including
children) with reduced physical, sensory, or mental capabilities,
or lack of experience or knowledge, unless they have been given
supervision or instruction concerning the use of the appliance by a
person responsible for their safety. Children should be supervised
to ensure they do not play with the appliance.
In certain circumstances, electrical appliances may pose a
danger hazard.
Do not place heavy objects in or on the appliance, use it for
storage, or allow children to play or swing from the door. The
appliance is designed for cooking food only.
This appliance is designed for domestic household use and
cooking of domestic food products only.

View Fullscreen

Instruction Manual
Built-In Electric Oven
OO654X OO654WA

Thank you for purchasing an Omega appliance
Tailored for the modern aesthetic and lifestyle of busy people, your new Omega Appliance will make a welcome addition to the family.
Omega caters to style-savvy customers who look for balance between stunning form and clever function. This means a combination of sleek, chic, sophisticated design yet effortless functionality. And we source from the best. The best craftsmanship. The best innovation. From the best international design-houses.
All brought together under an appliance that stands for design-led balance.
Please take the time to read through the following instruction manual to familiarise yourself with the installation, operation requirements and maintenance to ensure optimum performance.

Further Information
For important information about your Omega Appliance such as warranty registration, manuals, features, and specifications please visit omegaappliances.com.au (if you are in Australia) and omegaappliances.co.nz (if you are in New Zealand) or contact our Customer Care team on the below email or phone numbers.

Registering Your Warranty
For peace of mind you can register your warranty at omegaappliances.com.au. Further information on the Warranty can be found at the end of this manual.

Our customer service team is here to help you with any question or concern.
Both teams are on call Monday to Friday 9.00am to 5.00pm and of course you can always send an email at your convenience.

Australia Contact Details
Monday to Friday 9.00am 5.00pm Email: [email protected] Phone: 1300 11 4357

New Zealand Contact Details Monday to Friday 9.00am 5.00pm Email: [email protected]
Phone: 09 415 6000

To stay up to date and find simple and easy recipes, follow us on our socials:
facebook.com/omegaappliances instagram.com/omegaappliances_aus

READ THE INSTRUCTION BOOKLET BEFORE INSTALLING AND USING THE APPLIANCE. It is important that you retain these instructions, proof of purchase as well as other important documents about this product for future reference. The manufacturer will not be responsible for any damage to property or to persons caused by incorrect installation or improper use of the appliance. Due to continual product development, Omega reserves the right to alter specifications and appearances without notice.
Contents
Important Safety Instructions …………………………………………………………………………………………………………………….. 4 Appliance Details ……………………………………………………………………………………………………………………………………….. 5 Electrical Connections ………………………………………………………………………………………………………………………………… 5 Installation Instructions ………………………………………………………………………………………………………………………………. 7 Operating Instructions ………………………………………………………………………………………………………………………………… 9 Cleaning ………………………………………………………………………………………………………………………………………………….. 15 Troubleshooting ………………………………………………………………………………………………………………………………………….. 15 Transportation …………………………………………………………………………………………………………………………………………… 16 Cooking Guides ………………………………………………………………………………………………………………………………………… 17 Warranty Details ………………………………………………………………………………………………………………………………………. 22
D· isposal Information
· · Most of the packaging materials are recyclable. Please dispose of these materials through your local recycling
depot or by placing them into appropriate collection containers. ·· If you wish to discard this product, please contact your local authorities and ask for the correct method of
disposal. ·
3

NImopteosrtant Safety Instructions

I(Mb) POthReTAApNplTianScAeFiEsTmYoIdNifiSeTdRwUitChoTuIOt aNuSthority from

IMPORTANT: Read the assembly instruction section and safety precautions of this booklet carefully before removing the

This

contents of this carton. appliance is not intended for use

persons

(including

children)

wiinthtrheedufciresdtpwhyeseickal,asfetensropryuorcr hmaesntealwcailpl anboilittipesro, ovride

lack of experience or knowledge, unless they have been given supervision or instruction concerning the use of the appliance

by a person responsible for their safety. Children should be supervised to insure that they do not play with the appliance.

2. In certain circumstances electrical appliances may be a danger hazard.

3. Do not place heavy objects in or on these appliances, or use for storage, or let children play or swing from the door. These

appliances are designed for cooking food only.

4. This appliance is designed for domestic household use only and for the cooking of domestic food products. Use as a

commercial appliance will void the warranty. It should not to be used in a marine environment or outdoors.

5. This appliance is supplied with a 15 amp plug. The plug has a large earth terminal that will not fit into a common electrical

socket. To install the oven, a special socket is required to be installed by a licensed electrician (if it does not already exist at the

point of installation).

6. If the electrical supply cord is damaged, either when being installed or after installation, it must be replaced by the

manufacturer, its service centre or similarly qualified persons in order to prevent a hazard.

7. The electrical connection must be accessible after installation. The appliance must be electrically isolated before any

maintenance can be performed, which includes changing a lamp.

8. Electrical connection must be made as per local wiring rules and regulations. Do not disconnect the appliance with wet hands

or bare feet, and do not disconnect the power cord with extreme force.

9. Always grasp the oven door in the centre of the handle as the areas around the door edges may be hot due to the escape of hot

air.
1(b0). EtnhseurAe pthpaltiathneckeitcishemn oisdwifeilel dvenwtiltahtoedutoramutehchoarnitiycaflrvoemntilation is in use while cooking in this appliance.

11. Do not store or use flammable materials or aerosols near the oven. Items made from aluminium, plastic or plastic film

should also be kept away from the appliance, as they may fuse to the surface.

12. Never line the oven bottom with aluminium foil, as the consequent accumulation of heat could compromise the cooking and

even damage the enamel.

in the first week after purchase will not provide

13. WARNING – The oven will become hot during and directly after use. Do not touch any components during this time, as they may

be hot and can cause burns. Do not touch the Use heat resistant cooking gloves where-ever

phoesastiibnlgeewlehmenenmtsovininsigdfeotSohdee arovnvdiecnceot:ookainvgoiudtbe1un3rs0nilss0.inC1ha1inldHdreoEnuLtsPhoof (ut4hld3e b5oev7ek)ne.pt

away.

14. Cleaning may only be commenced on the appliance once it has cooled down (best slightly warm). The appliance should be

adaissmtceoaonmunenjcetttetoodrfaaronmmy oatthjhoeerrpfohawigilheurproerue.stlTseuthroeercbtleuearnnneiendfgiotesfqf tuaoitpyymooeuunr tistoolactlieoannstwheitcahppbleiafonrcee.coFomllmowenocvinegn

any cleaning process. Do not use cleaner directions if these are

being used.

15. Wash all accessories in hot soapy water or in a dishwasher, wipe dry with a paper or cloth towel. If you use your oven for an

extended period of time, condensation may form. Dry it using a soft dry cloth.

16. When the appliance is not being used, the knobs must be kept in the `OFF’ position.

17. Where this appliance is installed in a caravan, it shall NOT be used as a space heater.

18. Do not modify this appliance.

19. Do not use harsh abrasive cleaners or sharp metal scrapers to clean the oven door glass as it can scratch the surface, which may

result in the glass shattering. Clean the glass door using warm damp cloth and dry it with a soft cloth.

20. All cabinetry and materials used in the installation must be able to withstand a minimum temperature of 50°C above the

ambient temperature of the room it is located in, whilst in use. Certain types of vinyl or laminate kitchen furniture are

particularly prone to heat damage or discolouration at temperatures outside the guidelines given above. Any damage caused

by the appliance being installed without adhering to the temperature limits set out above will be the liability of the owner.

21. This appliance must be correctly installed by a suitably qualified person, strictly in accordance with the manufacturer’s

instructions. Please see the specific section of this booklet that refers to installation.

22. The appliance must be installed and put in operation by an authorised technician under the conditions provided by the

manufacturer in this manual. The manufacturer cannot be held responsible for any damage that might occur due to faulty

installation.

23. The values indicated on the printed documents found on the product are values obtained in laboratory environment

according to relevant standards. These values may vary according to the usage and environment conditions of product.

24. This operating manual has been prepared jointly for multiple models. SSomerevoicf eth:e specifi1ca3ti0o0ns1e1xpHlaEinLedPin(4th3e5m7)anual, may

not be included, in your appliance. Pay attention to the explanations with illustrations while reading the manual.

amount to a major failure. The benefits to you

3 241

NAoptpelsiance Details

A(bP) PLthIAeNACppEliDanEcTeAisILmSodified without authority from

EALPEPCLTIRAICNACLEDDETEATILASI:LS

OVENS:

OO654X and OO654WA

in the first week after purchase will not provide

RELaEteCdTVRoICltAaLgeD: ETAILS: 220 to 240V ac 50 Hz

MOVaExNRSa:ted Inputs:

2O0O0605W4X and OO654WA

SRuaptepdlyVCooltnangeec:tion: 2O2V0ENtoS2-4100VAacpl5u0g Hz

TMhaisxiRnafotermd aIntpiountsc:an be f2o0u0n0dWon the rating plate (data label) affixed to the inside of the door jamb.

SIZES:

RSueplepvlaynCtoSnizneesc:tion: LENOGVTEHNS(m- 1m0)A plugWIDTH (mm)

HEIGHT (mm)

ETxhtiesrinnafol rOmvaetniosnizecan b5e9f5ound on the ratin5g7p0late (data label) af5f9ix5ed to the inside of the door jamb.

SIZES:

Relevant Sizes:

LENGTH (mm)

EENExLtloEeertCcneTatslRrOiIcCveaAnlLsCiCzeOonNnN59eE5cCtTiIoOnNsS

WIDTH (mm) 570

HEIGHT (mm) 595

E(bL)ECtThRe IACpLIAnpOsLlitCaaCAnllOLacteANioUiNsnTmEiHsCoOoTdRnIilfIOyiTeYNpdeRSwrEmiQthitUoteIuRdtEabMuytEhaNolTriicSteynfsreodmelectrician, and carried out according to instructions
provided by the manufacturer. Incorrect installation might cause harm and damage which the mLOaCnAufLaActUurTeHrOacRcIeTpYtsREnoQUreIsRpEoMnsEibNilTitSy. ELECTRICAILnIsNtaSlTlaAtiLoLnAiTsIOonNlyFOpeRrmTHitEteLdICbEyNaSEliDceEnLseEdCTeRleICctIrAicNianin, tahnedficrasrtriweedeokuat fatecrcoprudricnhgatsoeinwsitllruncottiopnrsovide TBaEphLeEpifsolCioraTevnReccInaeCrAmirdypmLeuirnnIsaoNgttnvibSofuidieTucfeaAatcdctotLtihoLunbeAnrnyeTecprotcIlOhaatneetcnNedce)emFtcpmotOatiounsaRnsun2tTfot2abHo0creEte-t2uhcsL4rhpeIe0eoCprVcnE.oksN5Iweinb0SdeciHElorfizDtorsyrrpu.eEopccLowptErleyrCiner,TsstsRthpuaIeopCllnpvaIdAotlyielNo.tnanItcgSeiemsetreirogavahttircihtntehegc:eaaoduvfasvteiihlaaehbtha1aleper3mpm0clo0iaaarin1dnn1cdsaesnHdu(dsEapt1mpaL5mlPayAgpv(epe4old3luwt5gaoh.g7niec)t,hhaetnhdethe mTBphleaaiftsioneors)ea;vemeclnaeorcmurtyrnuiicntsgttwoboireauintcmgothnasehnjooecruocftlndaenidbleuetcrotesioua. niT2taht2obe0l-te2bh4feeo0nrpVeotfh5wite0seHortzvosepuynopo’wpsulepyr,otswhueeprpvrolaylt.tiaIntggies(raealastrointhigneoddifcvtaihateetdhapeopncloitarhndecaeanp(dsptl1aia5mnApcpeelduidgoe.nnttihfiecation aTphpelsiawnictcehieddenotuiftilceattimonusptlabteec)omnunsetcbteedcthoecakseuditfaobrlecoerarertshpownirdinegn,ceintcootnhfeoramvaitiylatbolecumrareinnst ssuapfeptly rveogltualageti,oannsd. the mThaisinaspeplelicatnrcicewmiruinstg bsheopulludgbgeedsuinittaoblae1fo5rAthswe iotcvheend’sopuotwleetr. rItatsihnogu(ladlsnooint dbiecaltoecdatoendtahbeoavpeptlihaencaeppidlieanntcifeicaantidonno pmlaotree);than 1.25m away from it. The power supply cord must not touch against any hot surfaces and must be Tphlaeceswd istochtehdatoiutstlteetmmpuesrtabtuerceodnoneescnteodt teoxcaeseudit7a5b°lCe eataratnhywpioringt,ailnoncognitfsorlemnigtytht.o current safety regulations. TAhftiesrahpapvlianngciensmtaullsetdbteheplaupgpgleiadnicnet,othae1s5wAitscwheitdchoeudtleotumtleuts.tItalswhaoyusldbenoint abnealoccceastseidblaebpoovseititohne. appliance and no mNtphlOaoecTrseeeEd:mtFhsoaoayrntchoo1avn.te2nri5thesmecttaeiatomwanpnsaedytrocafarttohutcmerhemfdiitaro.eienT.sshnepooptwoeewxrceseruepdsup7ply5p,°lCnyeacvtoearrdnuysmepuoasidntatnpaotleotrntsgo, uritecsdhlueacngtgiaotihnn.sstoar nmyuhltoiptlesuprofawceerspaonindtsmausst be TAhfteermhaainvisntgeirnmstinaalllebdlothcek iasplpolciaantecde,otnhethsewbitacchkeodfotuhteleotvmenusatnadlwthaeystebremininaanls aacrceeascscibelsesipbolesibtiyono.pening the tNeOrmTEin: aFlobrlcoocnknceocvteior.nNs ototet:hTehme ateinrms pinoawl ecrovsuerppshlyo,unledvneortubse oadpaepnteedrsw, hreednutchteiomnsaoinrsmpuolwtieprleispsotwillecropnonienctsteadsto thesaepmplaiaynocveearnhdeanteavnedr bcaytacnh ufinrea.uthorized person. The mains terminal block is located on the back of the oven and the terminals are accessible by opening the Tmttehhareemnaeuipnlfepaaccllittabrunilcrocaecelrksadacneofdecvlteniynree.ovsNfeatorhltbliesry:eaaTspnhppeoulnintaesanirbucmitelhiitncoyaarnflizoceorodndvleapyrmebsreashgoogenuu.raldersanunolttteinbegedfoirfpotemhneeaodnvwiennhsteiasnlclatohtrieroenmctwalyihnaiscnhpdohewafsefirncioiestnsbttlieylleecnoaerntanhreetchdte.edTdhteo correctly. Tmhaeneuulsfeaeccottruficraaedlrasdpaetfeclrtisyn,eomsf uathlltliisrpealesppspoolnicaskniebctielsitcayannfdo/orondrlayemxbteaeggneusiraoernsausn,lttieisnengdofitrfoatmhlloeSawoenevrvidenin.csteias:lclaotriroenctw1ly3h0aicn0hd1he1afsfHincEioeLtnPbtley(e4en3a5erta7hr)ethde. dThe correctly. The uasemoofuandtatpotearsm, majuolrtifpalielusroec.kTehtseabnedn/oerfietsxtteonysioouns, is not allowed.

4 251 4

NOovteensLamp Replacement
(ObV) EtNheLAApMplPianRcEePiLsAmCoEdMifieEdNwTithout authority from
· The appliance must first be disconnected from the power outlet or turned off at your isolation switch. · Unscrew the glass cover attached to the lamp holder; antii-ncltohcekwfiirsset.week after purchase will not provide · Unscrew the lamp and replace it with another high-temperature lamp with the following characteristics:
Type: E 14 Voltage: AC220V-240V Wattage: 25W Temperature rating: 300°
· Remount the glass cover and reconnect the appliance to the power supply NOTE: Should you experience any difficulty please contact your nearest after-sales service centre.

amount to a major failure. The benefits to you

Service:

1300 11 HELP (4357)

5 261

NInostteasllation

INSTALLATION

(b) the Appliance is modified without authority from

he adjacent furniture muTsthebeadajbalceentot fwuritnhitsutarendmausmt ibneimaubmle tteomwpeitrhasttuarnedraisemoinfim50u°mC atebmovpeertahteure rise of 50°C above the

mbient temperature ppliance must be cut

of off

tbhaaeempfoprbrloieiaeonanmncteytitemamdisujpusltoestrbcmaaetteucenurdettsionoof,frf dtbmhueearfiionnrrogteeopnamenarnyicotaeddisswjuloostfrcmkautiesseendd.tosTinnoh,erediomnpunaortiihwntn.egteerfpnirseasurntipcowpedlesyweootkofrkautfihstseedr. opTnhueercophnoaiwst.eerwsiull pnpolyt

ptorotvhidee

N FOR INSTAPLRLEAPTAIORNATAIONND FUOSER INSTALLATION AND USE with best quMaliatnyupfarcttsuarend wmiathtebreiaslts,qtuhaislitmyopdaertrsn,afnudnmctaiotnearilaalsn,dthpirsamctoicdaelronv,efnunwcitlilomnaeleatnydoupractical oven will meet your spects. Makenseueredstoinraelaldretshpeemctas.nMuaalkteosoubrteatino sruecacdetshsefuml raensulatlstsoooabstnaiontstuocecxepssefruiel nrecseualtnsyso as not to experience any e future. Thepirnofbolremmastiionnthgeivefuntubreelo. Twhceointfaoirnmsartuiloens gthivaetnabreelnoewcecsosnatrayinfosrrcuolersretchtaptoasrietinoencinegssaanrdy for correct positioning and ons. They shsoeurlvdicbeeorpeeardawtioitnhso.uTthfeayil,sheospueldcibaellyrebaydthweittheocuhtnficaiial,newspheociwalilyl pboystithieontetchhenaicpipanliawnhceo.will position the appliance.

LACE FOR THCEHAOPOPSLINAGNCAEPSLACE FOR THE APPLIANCES eral points toThpearey atrteensetivoenratlopwoihnetsn tcohopoasyinagttaenptliaocnetfoorwyhoeunr cohvoeons.inMgaakeplsaucree ftoor tyaokuer ionvtoen. Make sure to take into commendatiaocncsoubnetloowurinreocrodmermtoenpdraetvieonts abneylopwroinbleomrdserantod pdraenvgeenrtoaunsysipturoabtiloenms,s wanhdichdamngigehrtous situations, which might
occur later! g a place for Wtheheonvechno, aotstienngtaiopnlascheoufoldr tbheepoavident,hatttehnetrioenasrehonuoldflabme mpaaidbltehoart cthoemrebuasrteibnleo flammable or combustible e close vicinitmy,asteurcihalassincuthrteaicnlos,seoivl,icilnoitthy,estucc. hwahsicchuqrtuaiicnksly, ocial,tchloftihree.tc. which quickly catch fire. ounding the oFvuernioturrceosoukrtroopumnduinstgbtehemoavdeenoofrmcoaotekrtioaplsmreussisttbaentmtoadtemofpmerateurrieaslsarbeosviseta5n0tCto°.temperatures above 50 C°. ges to wall caRbeiqnueitrseadncdheaxnhgaeussttofwanasllacbaobvineeatsbaunildt-ienxchoaoukstofpanassawbeolvleasambuinilitm-inumcohoekitgohptsafsrwomelltahseminimum heights from the e shown in Fioguveren1b.oAacrcdoarrdeinsghloy,wtnheineFxihgauurset1f.aAncschoorudlidngbley,atthae mexihnaimusutmfahnesighhotuoldf b6e5 acmt afmroimnimthuem height of 65 cm from the re is no exhacuosot kfatonpt.hIef thheeirgehtissnhouelxdhnaoutstbfealnesths ethhaenig7h0t csmho.uld not be less than 70 cm.

amount to a major failure. The benefits to you

Service:

1300 11 HELP (4357)

6 271

NInostteasllation

(b) the Appliance is modified without authority from

INSTALLATION OF BUILT IN OVEN

Insert the oven into cabinet partly by INSTALLAToIOnNthOeFoBvUeInLTfrINamOeV.EWN hile the product

pfruasmhiengtoiut cfoherws athrde.wOopoednetnhisenuorthfvaeecnefidrosoftotwhr eeanecdakbianinfsteeetrr,tpt2iugshrcctrehenawstsheeinwsticollretnhwoest .hporolevside

TiIonnhncseertehrdtaeimstoehevseneionsnTiIivnnothfeecsrnenamursmelidapnaaeniettms.odrienaWemcstgauhnaibrpinstleieeain.otrertIeinnhttamseslpaonapapcfrernoettoerlhdrydradeeubmtccctyutatoaripbfnterbuiesan.setrmehIaintalifelniialtnagtttooiwecoifutodnhctf,roihhcircernheeowsnctacathttharawedeibcn.oatiwsOnvywtoeepaitontetolhdlnwiaeneettinllhnilewosebscunhtueorr,irfiviccnaceehacsonlttentaohdholtraloafeeitondtchrotstmhueavwleneucadayistntetbhicdnwibnaseepeinellatclren,rotbcttor2sitergtremshiibcccntutreeasesanlttwrnaotebdshlremleireniepnodstsrcosveirsmuveettehalwduannessttbt.ehteyoddbtl.oueepssacinrotgrsraemncuyt saktninbdderoepfsreitsovteaonnl.ttedt.o

Insulating pIanrsttsanleliendgttohbeeafipttpeldiainncaewianytthoeencslousreetvhiactinthiteyy ocafnanoret fbreigreermaotvoerdobryaudsiengepan-fyrekienzdeorfitsonolo. t recommended as the

Installing thpeearpfoplriamnacencinethoef tchloeseavbicoinviety-mofeanrteiofrnigeedraatoprpoliraandceeespw-friellebzeernisengoattriveceolymamfefencdteeddasdtuhee to emanating heat. After removing

pyaopeuprfrloiaornmvceaenn, fcdyareooopmoupnforliitttahosunevpsceaeaebnci,kot;fadvrigemooi-nmmmngoe,eibndttetsiuaiosptsneuealerycediktct;aaohpingampttinalmticaghtne,eacbdoneevisaaewsutneutilhilrlsyoebnreciotzohnteneahdgttaSaartemtchirtvveeeiadcloyne. vIaCnaefeufcnenatctshitrseeeo,nd.ryioodztuueehdsuatSosrepmeermvcetiadcone.faItaCninnecygnadhtsareeema,.tay. goAefutteosrutrhseepmeocvtinogf any damage to the

amount to a major failure. The benefits to you

Service:

1300 11 HELP (4357)

7
281

NOopteersating Instructions OOPPEERRAATTIINNGG IINNSSTTRRUUCCTTIIOONNSS
(b) the Appliance is modified without authority from FFRROONNTT VVIIEEWW:: in the first week after purchase will not provide

IINNTTEERRNNAALL VVIIEEWWSS::

amount to a major failure. The benefits to you

Service:

1300 11 HELP (4357)

12345671234567…………..

CHOCTOTCHOCTOToorrhhooaavvvvaappiinnnneeeellyyddttddnnnnHH..rrllLLooBBDDeeeeooll..aaooooccPPttttookkiittaannrroonn((..ggnnmmeeooEEll….lltteeaammvveeaaiinnllaatt..bbllee oonn tthheessee mmooddeellss))..

111100110011112200898933………… TTOOFFWWAARRaauuaaiivvrriinnrrccrreebbOOkk..eennoossuuGG//LLttHHSSiirrllggeehhiieellhhlltteeaa..ttllSStt..ffiihhnnHHuuggoottEEttllddeelleeeerrssmmrr..ssee.. nntt..

esItUPesIWWtUPnniiaallrrmmnneemomohhooppmmeetteerreelleerrddununee,,cctteeggnnttyyiiiirrffmmttooyyyyssaattoouuooee..oovvuuuuFFaaffyyccrrooiirriioorroollaarrssaaaauuoottppppbbttkkhhnnprrppplleeuuiiiieellllssnnii,,iinnaaeeaarrnnnnyyddnnyyeeeeooccccooaatteeeeuueeoouussddrroowrrwffpspsrrnnoooooohhrrtt,,vvoovvoomemebebeeeppnnnnbbeenneeaaf,f,eeiirrttoottaattllmmppyyhhrriisccseerreevvooeeoonnuueessrrooggoottppnnssvvrraattiihhttaaeenniiiiiinnmmeellnnnnggaarrssttmmyyiiffuuccmmeeuuoosseenneeeeuutteeddhhccff..rrllff..lltteeeeooiiwwOOoocceevvnnttttiieennllsshhllnnvv..aaeebbii,,DDnnrrrreerroowwddoouueenniittnnnnssmmmmeeeeooiimmttaa,,eettnntteennppllhheeaammtteeeeaattrriieeppvnnvaaooddeettttvvwwyyuuiiaaeettrrhhaarrnneeuuttiiiiccsswwnnssmmiihhnneeddiiaallttggtteellhhttxxrrnniiffiieennrrmmoottoogghhoottmmuueevvccoommooeeeeppttnnnnhhffeettfftteeeeiirreerrssaammoocciiiittnnllttnneessppssssss..eeuunnoottrraalleeffaaaalleettlltttteehhddiiuuooddeerrttnn..eeoossmmuuffbboonnaaeerr,,tt44aaeerraadd55rriiiijjaannmmuull,,ssssiissttnnaaeennuunnddoottddwweeaassttnn,,..hhddddAAeeuutttthhsshhtttteeeehheeaaeeoottttvvccee..eerr nn

29881

NOopteersating Instructions
(b) the Appliance is modified without authority from
CONTROLS

in the first week after purchase will not provide

OVEN FUNCTION/WARNING LIGHT CONTROL The oven function/warning light control button is used to select the different functions (an example is figure 11). Each is explained in detail. To select a function, turn the control knob to the desired oven function and then set the temperature with the thermostat control. OVEN THERMOSTAT CONTROL The oven thermostat control is used to select the desired temperature for cooking. When the temperature inside your oven reaches the value set, the thermostat will cut the circuit and the thermostat light will go off. When the temperature falls below the set value, the thermostat will again be turned on alongside the thermostat light. It is normal for this to occur during the cooking process, particularly when the door has been opened.

Service:

1300 11 HELP (4357)

amount to a major failure. The benefits to you

Fig.11

1201

NOopteersating Instructions
(b) the Appliance is modified without authority from OVEN FUNCTION CONTROL CHART The oven’s mechanical timer must be on and in use or the controliknntohbesfeirtsttowmeaenkuaafltfeorrptuhercohvaesnetwo iwllonrokt. provide
Note: Oven shelves are numbered from 5 at the top down to 1 at the bottom when referring to the food cooking chart. During heated oven functions a cooling fan in the top of the oven Sweillrvoipceer:ate in o1r3de0r0t1o1coHoEl LdoPw(n43th5e7)oven door and kitchen cabinet as well as reducing condensation in the oven. There will then be a slight release of warm air from tahmeotoupntotfothaemclaojsoerdfaoivluerned. oTohre. Tbheisniesfintsottoa lyeoauk in heat from the oven cavity.
1211

NOopteersating Instructions
(b) the Appliance is modified without authority from
OVEN FUNCTION CONTROLS

in the first week after purchase will not provide

You can start the defrost operation by putting the frozen food into oven and bringing the function control knob to the indicated mark. This function will not cook/bake the food; it only helps to defrost it within a short time. Put the food to be defrosted on the wire rack that you will place on the third rack support from the bottom (Figure 13). To collect the water that accumulates due to the melting ice, insert an oven tray onto a lower rack. This function is perfect for finishing off the defrost process for frozen food that has been in the refrigerator from the evening before and may not be completely thawed out.

Fan Forced Function:

Service:

1300 11 HELP (4357)

This Fan Forced function uses the turbo heater (located in the back of the oven) to evenly disperse the heat in the oven.aTmhiosufunnt ctotioanmisasjuoirtafbalielufroer. cTohoekibnegnmeufilttsiptloe ydoisuhes on various oven shelves. Adjust the function control knob so it indicates the Fan Forced function symbol. Adjust the thermostat control knob of your oven to a temperature recommended on the cooking table for the cooking operation you wish to perform. Preheating of the oven for about 10 minutes is recommended. Place the food in a suitable container, then place into oven and cook for the required time. If you are going to cook using two trays at the same time, while adjusting the cooking temperature, select the temperature that is the lowest among the levels suitable for your food of choice, as shown on the table. Cooking with two trays requires additional cooking time compared to cooking with one tray. Usually, the food on each tray does not finish at the same time so you may need to take the tray of cooked food out of the oven, and continue the cooking operation for the remaining tray. After cooking, turn off the oven function and temperature control knobs and cancel the timer program if in use. Take the cooked food out of the oven and place it in a safe heatproof surface. As the oven will be hot, work near with caution and keep children away from the cooling oven.

1221

NOopteersating Instructions
(b) the Appliance is modified without authority from

Mid-Grill Function:

in the first week after purchase will not provide

This function is used for grilling. Adjust the function control knob so it indicates the Mid-Grill function symbol and adjust the oven timer to the recommended time for cooking. Set the oven’s thermostat control knob to the required temperature. After a preheating period of 10 minutes, put your food into the oven. For grilling, put the food on the grill rack and sit into the tray. Place the tray on the highest shelf (5). Placing the rack within the oven tray provided will ensure that any marinade, fat or oil dropping from the food will be collected. When grilling, the oven door must be closed. On this function, the middle heating elements/coils of the grill operate.

This setting is ideal for toasting bread, cheese melts and melting cheese topped dishes or finishing off a dish to lightly brown on the surface. Also used for herb and garlic bread. After cooking, turn off the oven function and temperature control knobs and cancel the timer program if in use. Take the cooked food out of the oven and place it in a safe heatproof surface. As the oven will be hot, work near with caution and keep children away from the cooling oven.

Mid-Grill with Fan Function:

This function will ensure complete, fast and all over grilling by working, the fan, the grill and the upper heating

element at the same time. Adjust the function control knob so it indicates the Mid-Grill with Fan function symbol

and adjust the oven timer to the recommended time for cooking. Set the oven’s thermostat control to the required

temperature. After a preheating period grill rack and sit into the tray. Place the

of 10 minutes, put tray on the highest

ysohuelrff(o5So).edPrivlnaitccoient:ghethoevrean1c.3k0Fwo0irt1hg1irniHlltihnEegL,oPpvu(e4tn3tht5rea7yf)opordovoindetdhe

will ensure that any marinade, fat or oil dropping from the food will be collected. When grilling, the oven door must

be cloasmedo.unt to a major failure. The benefits to you

The Mid-grill with fan function is ideal for cooking food to achieve a crispy skin (such as chicken thigh or breast with the skin on) and lightly browning meat such as lamb and seafood. After cooking, turn off the oven function and temperature control knobs and cancel the timer program if in use. Take the cooked food out of the oven and place it in a safe heatproof surface. As the oven will be hot, work near with caution and keep children away from the cooling oven.

ENERGY SAVING

Choose cookware of an appropriate size. Using a lid will reduce cooking times. Minimize the amount of liquid or fat to reduce cooking times. Oven door should not be opened often during cooking period

1231

USING THE MECHANICAL TIMER

OUSpINTeoGrasTettHinaEgtMimIEenC, srHotAtrauNtecICtthAieoLtnTimIsMerEcRontrol knob clockwise to a certain time range between 0 –

100 minutes, as shown on the picture (Figure 16). The oven will stop when the set time

(UT1rTbaoh0Sn)i0sIsgNrTceeimasohttGhnioiirsansegekTcueiftisAoneiHtmiemrgrpsEresepefcp,fu,oMeldlianeramrstortcEnoeepttscCiaddlaoheetH,sontetaoeiwsMAsntdaahNndam,snenaItodMCohuntnidceAadmaoiltnLftthoeiuihuemrTekseadeiIecnlpMtorwougiimncrwsiEtttetiMehuirRmlorolroaeelgrwun.ikMtv(iunlFealaaoiggulanbiuotnvuhrpceaeaoleloaurro1cnidatkp6ytiawbie)ou.flrriendasToe,tiwhmbiwoetaleonhron,ewavwinneachgyrneneoroiwntunnaigycwilnloeoa.sutnntiomcwteptae.onwtrtaahtlnoecgntoeanltbthcreoeotnlwsoterefotetlnhtoiem0f te-he

Tcoooskeint gaftuimncet,iornostaatnedthcoeotkiminegrticmonet.rol

knob

clockwise

in certain

the first week after purchase time range between 0 –

will

not

provide

100 minutes, as shown on the picture (Figure 16). The oven will stop when the set time

range is completed, and the timer will give an audible warning once.

This is referred to as Manual use or Manual operation, when you want total control of the

cooking functions and cooking time.
ACCESSORIES

ACCIatElsiSsoSrueOsceoRmgIlEamsSes ncdoendtatihnaetrsy,ocuakuesepathnes

containers indicated depending on the food you will cook in your oven. You can and special oven trays suitable for use in your oven (available in kitchenware

Iatlsisorsbuehescoleoopmwgsl)am.sshPesoancyudoladentdttbaeteinhnitaemitrospyn,loectuoamkuteehsneepteatinhdnfesofoacrmronndeatntsaaipoimnenecegrilasilvelieodnnvdceiobcnnaytttterahadienydessreusspup.eiptnalidebirlnefgoforornuustesheeoifnfotyhooidsuycroooouvkewwniall(racevo.aoTiklhaeibnlienyfoionurrkmiotacvtheioennn. wYgoiavureecnan

AsbheColoCptIwfsrEa)t.SshyhPSeioasOfyuoulRaosdetdItbEdeteSnotoitmbioceponlcleltoeomocttkehentehdteeidnddofofreoirpsmrpneiaonnttgaiocmjnouemigclilepveseldenotcfeobtlnyyhtetcahoifenvoeeosrrudspts.hpdeluieorrivnefgonrtthureaseyg,roiiffllttohhpeisefcroaootoidokwnis,atdraeekf.eoTnrhmoeuaitntiofoofnrtmmheaigtdihoetnepgb-ievfreoenbezseerrvoerdifotnhe

ttsttsataoIIIasbtffrhrhhtthfdlenaasaatttieeeodlsoehhyyttoapeettlreertsataoswaiiurrsdhhetssofdcnttaar)ffsatcreehhogoom.duusyyeeytoaehaaoPoossetlroosmeagpreettoadkddowctavvlriddiyrrurwamhoegmneeytteeyislrecaoooattgrradssesoeeooepttktuuttwnbbivtbceiiniirowllocceenmmedeeotteerioovrfncssgtraensiecceeeellhitcntudddllmttooineeeelniaotoddlouuomootcctormpivuurnfrrsthntttkkaileiiheheetcena.enneedtttchnelhhoDtmrtdoddgguokttiosmooeesyur/rortttt,ddeagihohehhttw.nddhhcnooncrhrueeeaDorrgiiikttaeeooggiliikoesl/rouyipphhssotthh,negd.hstwppeehdinnpnfrrntteIepiioaafieioonaleeoonnglsoattarltnytthmmoteggh,cmrahntt.eccrdeipbrrejjeppsntItgooaauuaaenleoneetsaracmmattnniinhmaieccarricaonlotssaaeteelrremppbrindffprdntgttnmssaeelloatuueteer,eagsnrraooghyairrrttolp..losiilaeffteeloreeniveDDtiefrdnntnmssttllpheeedayycuoohh,tgeerffcnyrioroeeaoo.cccsoorrnneooiooblDtawrronnlooffisphmmdonvvntyooontttiieefcevsdtooooaetoiilloarrenennriheeddnnawrcoil,oonggttaaenmdss,datnthhftivvieutddsthddosaeeeiwteeelrersnuuueeuunhnasde,ooogepaarrarr,e.ydgtiifiivvtvptdunnsnnhlgglheewtaesleosgguggllesihnnueaaseepwuearesttttssgrrietsttihhhhnfssetlgtrrhlhfanaeesaeeorgraalottecueasadbrrwyyrccrggestlsaayrila,,fshoonrrefssSueyythciiaoiiieoo.grffrllsntkefecllooarEkkerottrcoseoorlayrrphhniicafrovnnonstppyoocceescoiioo.uggfnceeuooknstorE//kffsthierrrsnnctoorbbtpenihcaaeaoen:itttoooaaocsittaaiiolgstniiuoddnkkflnsniioohe/onncieiirnctbtnnnnyiiacoe4oaeeorssittoaggto,,daoirrlmtttonkddlufntioohkaaeiianyrheieernninwkk1appct4goere5ffoeetgtee3aahoooaury.movnnfrrt0trrroriccaerhaaswmmnei0oopboootglntte5.oiiieuurllahaaiolyoo.ddT1lewl(rtt.tttrac1hnncaasiieeTooloobovooe..lytknnooHffannirlTTi.odclivvewitt.nhhmIEklmmoniihhfaaeTrrlfiio.LysseeikoooybanoiinTggl.oPknnrliicvddesshhomhmIyeuommifeertt(oifaaiosocyaaeef4naeeullnnotkppnrbi3ennbbrskioeeooumo–y5atteeiofffatrrngnrrc7fapiicmmevoommeeolnirb)hleegnnbbeeaeioaayemminantgczzssvllrngn,,.geeeeipiemeeenmowppYirrrrlntnddagavvioahhomooansgiiceelaauyytirrr,giuehddeenttsspiiceesriietdaffgccooha,eollmsittaayynnnaytihhullehtseeesriec,elmayl

after cooking in them. Do not place them on cold and wet surfaces. Ensure that they slowly cool off by placing them

(obn)a dathrmyepoAiuepncpetlitoaofnaccleomtihasjoomrrowfadoiilfouiedreden.wTbihtoheaorbudet, noateuhftiehtsrowrtioitsyey,fortouhme glass tray or container might break. If you are going to use

the large wire oven rack/grill, insert a tray into one of the lower racks to collect fat or oil. To make cleaning easier,

add some water into this tray. In a grilling operation, use the shelf in position 4 or 5.

in the first week after purchase will not provide

13 131241 Service: amount to a major failure. The benefits to you

1300 11 HELP (4357)

NColetaensing (N(TdldldldldldldltttttttfdtdtfdtfdtfdtfdtfdtfwtDUwtDUtDUwtDUwtDUwtDUwtDUwCCBCMTIIICUCICCBCMTIIICUCICCBCMTIIICUCICCBCMTIIICUCICCBCMTIICUCICCBCMTIICUCCCBCMTIICUCiiiiiiifffffffffffffffffffffffbbooooooohhhhhhhhhhhhhhhhhhhhhqqqqqqqoooooooiiiiiiillolllolllolllolllolllollloleeeeeeeoooooooRRRRRRRsssssssnnnnnnnLLLLLLLrhhhhhhhssssssseeoeeoeeoeeoeeoeeoeeottttttttttttttttttyyyyylllllll))eeeeeeeeeeeeeeeeeeeeeaaaaaaaouuuuuuueeeeeeeffffffflllllllooooooohhhhhhhhhhhhhhhhhhhhhhhhhiiiiiiioEEEEEEEiiiiiiioooooaaaaaaaaaaaaaannnnnnnooooooocccccccOOOOOOOkkkkkkkooooooonnnnnnnnnnnnnntttttttllllllliiiiiiieeeeeeeaaaaaaakkkkkkkt········································eeeeeeeeeeeeeeeeeeeeeeeeekkkkkkkdddddddnnnnnnnnnnnnnncccccccuuuuueeeeeeeooooooowwwwwwwAAAAAAArrrrrrrcccccccoooooooussssssseiiiiiiipppppppnnnnnnnfffffffttaUUUUUUUrrrrrrreeeeeeesssssssiiiiiiiiiiiiiinnnnnnnllllllltttttttmmmmmmmooooooooooooooiiiiiiiFFFFFFFiiiiiiihhttttttttttttttnnnnnnnnnnnnnnssssssshhhhheeeeeeeiiiiiiioooooooNNNNNNNpppppppnnnnnnnaaaaaaannnnnnnmsbhhhhhhhnnnnnnnggggggglllllllsssssssuuuuuuuvvvvvvvvvvvvvvuuuuuuusssssssBBBBBBBeeuuuuuuuggggggggggggggaaaaaaaaaaaammmmmmmtttttttaaaallllllltttttttoooooooiiiiiiipppppppTTTTTmCTPTTTTTmCTPTTTTTmCTPTTTTmCTPTTmCTPTTmCTPTTmCTPeeeeeeegggggggttttttteeeeeeeeeeeeeeiiiiiiisssssssIIIIIIIssssssshhhhhhhrrrrrrreeeeeeemmmmmmm(((((((ssssssslvvvvvosssssssaaaaaaaLLLLLLLaaaaaaakkkkkkkNNNNNNNttttttttttttttAAhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhheeeeeeeiiiiiiihhhhhhhooooooooooooooiiiiiiieeeeeeennnnnnnnnnnnnneeeeeeeeeeeeeee)))))))rrrrrrrhhhhhhheeeeetttttttooooooolllllllfffffffnnnnnnnhhhhhhhhhhhhhhaaaaaaauiiiiiiirrrrrrrEEEEEEEllllllleeeieeeieeeieeeieieieieeeeeeeeeeiiiiiiiwwwwwwwhhhhhhhnnnnnnnnnnnnnnlllllllppdddddddiiiiiiiiiiiiiittttttttttttttsssssssooooooovvvvvvvcccccccGGGGGGGcccccccbbbbbbbnnnnnnnlllllllscccceeeeeeeeeeeeeeddddddddddddddcccccccnNTbNTbNTbNTbNTbNTbNTbaaaaannnnnnnnnnnnnnoooooooSSSSSSSoooooooiiiiiiiooooeeeeeeetttttttgggggggaaaaaaalllllllppeeeeeeeaaaaaaaeeeeeeeThlThlThlThlThlThlThlohohohohohohoheeeeeeelllllllnnnnnnnrrrrrrryyyyyyyuuuuuuuooooooooooooooiiiiiiinnnnnhhhhhhheeeeeeetrrrrrrreeeeeeeggggggggggggggaaaaaaaeeeeeeehoooooooiiiiiiiwwwwwwwOOOOOOOsssssssrrrrrrrHHHHHHHuuuuuuummmmmmmnnnnnnniiiiiii…….lleeeeeeevvvvvvvooooooorrrrrrrooooooonnnnnnnooooooowwwwwwwggggggguuuuuuuaaaaaaaeeeeeeeeeeeeeelllllllaaaaaaayyyyyeeeeeeemmmmmmmfffffffmmmmmmmiitwwwwwwwaaaaaaavvvvvvviiiiiiioooooooooooooommmmmmmaasssssssaaaaaaaeeeeeeeTTTTTTTooooooooeeeeeeeaaaaaaatttttttouuuuuuulllllllllllvvvvvvvgggggggnnnnnnnfffffffssssssssssssssnnnnnnnOOOOOOOiiiiiiinnnnnnnpppppppeeeeeeettttttthhhhhhh…….tttttttfffffeeeeeeeaaaaaaaaaaaaaasssssssvvvvvvviiiiiiinnnnnnnEEEEEEEnnnnnnnnntttttttpppppppeeeeeeetttttttrrrrrrrrrrrrrreeeeeeehhhhhhhsssssssooooooopppppppeeeeeeerrrrrrriiiiiiippppuuuuueeeennnnnnnnnnnnnniiiiiiinnnnnnneeeeeeeeeeeeeeaohhhhhhh——-iiiiiiirrrrrrreeeeeeepppppppccccccceeeeeeeeeeeeee:::::::nnnnnnnrrrrrrreeeeeeeOOOOOOOsssssssnnnnnnnccmmmmmmmssssssstttttttllllllllllllllrrrrrrruuuuuuuDDDDDDDiiiiiiirrrrrtttttttmmmmmmmiiiiiiioooooooooooooonnnnnnnnnnnnnnuuuuuuucccccccuuuuuuueeeeeeerrrrrrriiiiiiipppppppnnnnnnnCCCCCCCooooooolllllllhhhhhhhssssssssssssssgggggggeeeeeeettttteecccccccaaaaaaa(((((((ccccccctnnnnnnnaaaaaaamiiiiiiippppppplllllllccccccctttttttttttttteeeeeeeiiiiiiiaaaaaaarrrrrrrTTTTTTThhhhhiiiiiiiggggggguuuuuuuggggggglllllllggggrrrrrrryyyyyyyooooooollrrrrrrrxxxxxxxeeeeeeeaaaaaaaoooooooilllllllsssssssfffffffsssssssfffffffrrrrrrrooooooogggggggiiiiiiieeeeeeeeeeeeeelpppppppllllllmmmmmmmdddddddeeeeeeeyyyyyyyooooooohhhhhhhiiiiiiiiihhhhhhhnaaaaaaaeeeeeooooooollllllleeeeeeepppppppttttttteeeeeeeaIIIIIIIhhhhhhhsssssssyyyyyyyaaaaaaalllllllmmmmmmmooooooosstttttttrrrrrrraaaaaaawwwwwwwtttttttrrrrrrraaaaaaaeeeeeeedddddddeeeeeeeNNNNNNNaaaaaaalllllllnnnnnnnuuuuuuueeeeeeeppppppprrrrrtttttttooooooohhhhhhhaaaaaaasssssssuuuuuuulllllllnnnnnnneeeeeeeaaaaaaannnnnnnjwwwwwwwfffffffaaaaaaavvvvvvvgbbbbbbbaaaaaaadddddddnnnnnnnooooooolllllllrrrrrrrlllllllorrrrrrrmmmmmmmtttttttmmmmmmmmmiiiiiiiaaaaaaacccccccrrrrrrreeeeeeennnnnnneeeeeeerrrrrrriiiiiiiyyyyyyyrrrrrrrppppptttttttffffffflllllllooooooommmmmmmaaaaaaattttttttttttttGGGGGGGiiiiiiiyyyyyyyqqqqqqqeeeeeeeeeeeeeeiiiiiiyyyyyyyffffffffffffffffffiiiiiiiruuuuuuupppppppeeeeeeeeeeeeeeoooooootttttttuuuuuuurrrrrrrhhhhhhhiiiiiiinnnnnnnhhhhhhhtttttttrrrrriiiiiiioooooooiiiiiiiaaaaaaatttttttssssssswwwwwwweeeeeeennnnnnnoooooooooooooooo:::::::fffffffuuuuuuuaaaaaaannnnnnnllllllllllllllpppppppsssssssrrrrrrrhhhhhhhoooooaaaaaaappppppprrrrfsssssssuuuuuuugggggggeeeeeee,,,,,,,oooooooaaaaaaaeeeeeeecccccccsssssssvvvvvvvbbbbbbbnnnnnnnaaaaaaaiiiiiiiagggggggvvvvvvvuuuuuuueeeeeee:::::::ddtttttttiiiiiiittttttteeeeeeerrrrrrrrrrrrrraaaaaaabbbbbaaaaaaaeeeeeeeaaaaaaahhhhhhhnnnnnnndddddddbbbbbbbccccccceeeeeeeccccccceeeeeeewwwwwwwdddddddeeeeeeeeeeeeeeooooooottttttteeeeeeeaaaaaaacccccccooooooorrrrrrriiidddddddrrrrrrrlllllllllllldddddddpppppppbbbbbbbttttttthhhhhhh…….laaaaaaaooooooopppppppffllllllnnnnnnn:::::::iiiiiiisssssssrrrrrrreeeeeooooooonnnnnnnnnnnnnnutttttttmmmmmmmcccccccvvvvvvvdddddddeeeeeeeiiiiiiiiiaaaaaaaooooooo:::::::nnnnnnnsssssssrrrrrrrrrrrrrrDDDDDDDtttttttrrrrrrrrrrrrrraaaaaaallllllluuuuuuueevvvvvvveeeeeeemmmmmllllllleeeeeeeeeeeeeedddddddruuuuuuuccccccc)))))))oooooooyyyyyyyoooooooeeeeeeerrrrrrriiiiiiisssssssaaaaaaauuuuuuuvvvvvvvgggggggeeeeeeebbbbbbbssssssseeeeeeeooooooocccccccllllllloooooooeddmmmmmmmooooooosssssssuuuuuuunnnnnnn(((((((gggggggdddddddtttttttmmmmmmmssssssseeeeeeeeeeeeeedddddddpppppppaaaaaaammmmmmmsssssttttttteeeeeeeccccccc…….tttttttnnnnnnnaaaaaaabbbbbbb.iiiiiiinnnnnnnrrrrrrr:::::::gggggggiiiiiiisssssssnnnnnnnnnnnnnnnnnnnnnuuuuuuucccccccnhhhhhhhtttttttlllllllwwvvvvvvvIIIIIIIfffffffvvvvvvvbbbbbbbwwwwwnnnnnnnfffffffsssssssaaaaaaaooooooolllllllTsssssssfffffffeeeeeeeiiiiiiitttttttaaaaaaaoooooooooooooooooooooooooooooooo,,,,,,,cccccccaaaaaaaeeeeeeeeeeeeeeeeeeeeennnnnnnooooooo,,,,,,,eeeeeeeeeeeeeeoooooooaaaaaaayyyyyyyyyyyyyyiitttttttdddddddiiiiiiittttttthiiiiirrrrrrrtttttttrrrrrrrbbbbbbbttcccccccwwwwwwwttttttttttttttrrrrrrrcccccccooooooonnnnnnnnnnnnnnhhhhhhhtttttiiiiiiihhhhhhhaaaaaaaccccccchhooooooo”””’rrrrrrreeeeeeeooooooosssssssnnnnnnncccccccnnnnnnneeeeeeedddddddeeeeeeeehhhhhooooooosssssssllllllluuuuuuutttttttfffffffttttttteeeeeee…….lllllllpppppppnnnnnnneeeeeee,,,,,,,vvvvvvviiiiiiioollllllliiiiiiieeeeeeerrrrrrroooooooiiiiiiiiiiiiiieeeeeeesssssssooooooogggggggeeesssslllllllcccccccFFFFFFFdddddddiiiiiiisssssssnnnnnnncccccccsssssssyyyyyyyyyyyyyyyyyyyeeeeeeewwwwwwwooooooobsssssssuunnnnnnntttttttaaaaaaatttttttnnnnnnnoooooooeeeeeeehhhhhhhaaaaaaatttttttccccccckkkkkkkoooooooooooooouuuuuuuuuuuuuuooooogggggggaaaaaaannnnnnnmmmmmmmennnnnnnlllllllssssssswwwwwwwttaaaaaaabbbbbbbhhhhhhhaaaaaaaooooooorrrrrrrsssssssiiiiiiitttttttnnnnnnnrrrrrrroooooooyyyyyyyrrrrrrrrrrrrrrsssssssrrrrrrruuuuunnnnnnnttttttt:::::::pppppppneeeeeeerrrrrrriiiiiiinnnnnnnaaeeeeeeeeeeeeeeiiiiiiisssssssnniiiiiiiiiiiiiittttttthhhhhhhttttrrrrrrraaaaaaannnnnnnkkkkkkkaaaaaaaccccccceeeeeeerrrrrnnnnnnngggggggnnnnnnnwwwwwwwttttttthhhhhhhiiiiiiitttaaaaaaaeeeeeeeeuuuuuuuiiiiiiicccccccuunnnnnnnoooooootttttttnnnnnnnhhhhhhhggggggghhhhhhhtttttttnnnnnnnggggggggggggggpppppeeeeeeecccccccrrrrrrreeeeeeeoooooooaaaaaaaeeeeeeecccccccpppppppdddddddcccccccfiiiiiiihhhhhhheeeeeeettuuuuuuugggggggeeeeeeegggggggttttttttttttttioooooooqqqqqqqrrrrrhhpppppppooooooodddddddtttttttmmmmmmmuuuuuuurrrrrrrccccccceeeeeeeteeeeeeepppppppaaaaaaaccccccciiiiiiihhhhhhhooooooosssssssoooooiiiiiiiscccccccmmmmmmmtttttttuuuuuuuoooooooooppppppprrrrrrrooooooolllllllrrrrrrrllllllloooooootttttttrrrrfffffffaaaaaaarrrrrrrttttttteeeeeeeeeeeeeepppppppoooooooddddddddddddlllllllrrrrrrreeeeeeeeeeeeeeeeeeeeetttttttiiiiiiiaaaaaaaooooooowwwwwwwooooooocccccccrreeeeeeefffffffnnnnnnnthhhhhhhoooooooaaaaaaaeeeeeeeaaaaaaappppppphhhhhhhnnnnnnneeeeeeeuuuuummmmmmmiiccccccctttttttodddddddllllllllllllllccccccccccccccnnnnnnnwwwwwwwsssssssttsssssssooooooolllllllllllllldddddddeeeeeeecccccccdddddddnnnnnnneeeeeeelllllllrrrrrrreeeeeeeoooooootttttttcccccyyyyyyyyyllllllleeeeeeellllllleeeeeee…….oooooootttttttaaaaaaaiiiiiiiooooooofffffffttttttteeeeeeelllllllaaaaaaarrrrrrryeeeeeeeiiiiiiieeeeeeettttttttttttccccccc)))))))vvvvvvvdddddddsssssssaaaaaaalllllllnnnnnnnrrrrrrrtttttttooooooohhhhhhhtttttttttttttt,,,,,ff:::::::nnnnnnnaaaaaaavvvvvvvyyyyyyyorrrrrrrrrrrrrroooooooeeeeeeeooooooossssssseeeeeeeeeeeeeecccccccrrnnnnnnniiiiiiigggggggvvvvvvvaaaaaaassssssspppppeeeeeee…….nnnnnnnbbbbbbbooooooopppppppeeeeeee…….oouaaaaaaaooooooonnnnnnn,,,,,,,mmmmmmmsssssssddddddd,,,,,,,eeeeeee,,,,,,,tttttttcccccccllllldddddddrrrrrrreeeeeeeooooooonnnnnnnooooooocccccccmmyyyyyyynnnnnnnttttttteeeeeiiiiiiicccccccrrrrrrrlllllllnnnnnnnsssssssmmmmmmmtttttttrrrrrrrhhhhhhheeeeeeehhhhhhhwwwwwwwsssssssooooooouuuuuuuoooooootttttttaaaaallllllltttttttaaaaaaaooooooo…….”””’oooooooeeeeeeefffffffaaaaaaaaaaaaaahhhhhhheeeeeeesssssssuuuuuuurrrrrrrsssssmmmmmmmuuuuuuunnnnnnniiiiiiieeeeeeepppppppuuuuuuuYYYYYYYooooooolllllllaaaaaaagggggggccccccciiiiiiinnnnnnneeeeeaaaaaaaeeeeeeegggggggtttttttnnnnnnndddddddrrrrrrroooooooeeeeeeesssssssrrrrrrrbbbbbbbccccccceeeeeeennnnnnnhhhhhhhuuuuuuutttttttiiiiiiieeeeeeehhhhhhheeeeeeennnnnnncccccppppppprrrrrrraaaaaaauuuuuuusssssssuuuuuuuccccccctttttttpppppppiiiiiiisssssssmmmmmmmvvvvvvvoooooooaaaaaaauuuuuuuaaaaa,,,,,,,sssssssuuuuuuunnnnnnngggggggooooooolllllllttttttttttttttwwwwwwwsssssssaaaaaaaeeeeeeeaaaaaaawwwwwwwtttttttrrrrrrrlllllppppppprrrrrrrtttttttppppppptttttttpppppppwwwwwwwcccccccllllloooooooiiiiiiirrrrrrrpppppppcccccccllllllliiiiiiiaaaaaaaoooooooiiiiiiiooooooonnnnnnnsssssssuuuuuuunnnnnnnpppppppiiiiiiirrrrrrrttttttteeeeeeerrrrrrryyyyyiiiiiiihhhhhhhnnnnnnnlllllllrrrrrrrnnnnnnneeeeeeennnnnnnwwwwwwwaaaaaaammmmmmmiiiiiiieeeeeeegggggggllllllleeeeeeessssssslllllllooooorrrrrrrooooooocccccccbbbbbbbaaaaaaalllllllyyyyyyyrrrrrrriiiiiiisssssssttttttteeeeeeeooooooo)))))))iSiaaaaaaayyyyyyysssssssnnnnnnniiiiiiillllllluuuuucccccccnnwwwwwwweeeeeeennnnnnnmmmmmmmccccccc…….ttttttteeeeeeeoooooootttttttiiiiiiibbbbbbbaaaaaaagggggggeeeeeeeerrrrrccccccchhhhhhhcccccccaaaaaaabbbbbbbsssssssWWWWWWWggggggguuuuuuusssssssooooooouuuuuuueeeeeeerrrrrrrttttttttteeeeeeehhhhhhhssssssslllllllcccccccreeeeeeeeeeeeeeAAAAA…….ttttttthhooooooorrrrrrreeeeeeeoooooooaaaaaaatttttttxxxxxxxoooooootttttttsssssssvdddddddccccccceeeeeeehhhhhhhiiiiiiieeeeeeeAAAAAAAhhhhhhhllllllluuuuuiiiiiiieetttttttppppppppppppppfffffff,,,,,,,ccccccctttttttllllllloooooooieeeeeeeoooooooiiiiiiinnnnnnndddddddeeeeeeefffffffhhhhhhhceeeeeeessssssshhhhhhhaaaaaaatttttaaaaaaauuuuuuueeeeeeeeeeeeeesssssssooooooo…….tttttttrrrrrrrfffffffhhhhhffettttttteeeeeeeeeeebbbbbbbrrrrrrroooooooooooooodddddddsssssssfffffffccccccctttttttiiiiiiiiirrrrrrreeeeeeeoooooooeeeeeeeyyyyyyynnnnnnnrrooooorrrrrrhhhhhhheeeeeeettttttt:mmmmmmmttttttteeeevvvvvvvfffffffiiiiiiiaaaaaaannnnnnnssiiiiiiihhhhhhhooooooolllllllrrrrrrrtttttttnnnnnnneeeeeeefffffffrrrrreeeeeeeeeeeeeeyyyyyyyssssssseeeennnnnnnwwwwwwwiiiiiiidddddddttaaaaaaaaaaaaaaiiiiiuuuuuuudddddddgggggggtttttttnnnnnnnaaaaaaatttttttsssssssdddddddsssssfffffffnnnnnnndddddddmmmmmmmsssssssrrrrrrruuuuuuurrrrrrrwwrrrrrrroooooooaaaaaaaeeeeeeeeeeeetttttttgggggggrrrrrrrtttttttyyyyyyy…….dddddddooooooowwwwwwwooooooorrrrrrrrrrrrrreeeeeeelllllllyyyyyyyooooooo…….dddddooooooottttttteeeeeeeeeccccccclllllllnnnnnnnmmmmmmmuuuuuuuaaaaaaahhhhhhhoooooooooooooosssssssiiiiiiitttttttaaaaaaavvvvvvvlllllllllllllleettttttteeeeeeeSSSSStttttttooooooonnnnnnnuuuuuuueeeeeeelllllllttttttteeeeeeessssssswwwwwwwuuuuuuueeeeeeehhhhhhheeeeeeehhhhhhh1kkeeeeedddddddwwwwwwwoooooooaaaaaaadddddddlllllllwwwwwwwnnnnnnnrrrrrrrtttttttdddddddttttttteeeeeeepppppppiiiiiiirrrrr3aaaaaaannnnnnnlllllllooooooonnnnnnnsssssssaaoooooooaaaaaaavvvvvaaaaaaasssssssppppppphhhhhhhooooooowwwwwww0aaaaaaaeeeeeeemmmmmmmgggggggfffffff…….tttttttiiiiifffffffffiiiiiiipppppppooooooopppppppeeeeeeewwwwwwwccccciiiiiiifffffffttnnnnnnnfffffffrrrrrrr0eeeeeeeIIIIIIIiiiiiiirrrrrrreeppppppptttttttaaaaaaaeeeeewwwwwwwsssssssnnnnnnntttttttrrrrrrrnnnnnnnyyyyyyydddddddrrrrrrrsssssssaaaaaaaeeeeeeehhhhhhhhhhhhhheeeeeeelllllllrrnnnnnnn1tttttttooooooommmmmmmtttttttiiiiiiidddddddCCCCCtttttttrrrrrrrtttttttttttttteeeeeeevvvvvvvaaaaaaappppppp1uuuuuuupphhhhhhhhhhhhhhuuuuuuuaaaaaaauuuuuuuhhhhhhhyyyyyyyeeeeeeeeeeeeeeeeeeesssssssnnnnnnnaaaaaaaaaaaaaaaaaaaaaiiiiiiieeeeeeeuueeeeeeessssssseeeeeeeoooooooooooooorrrrrrrnnnnnnnnnnnnHsssssssnnnnnnnccccccccccccccyyyyyyyiiiiiiillllllleeeeeeennnnnnnnnnnnnnrruuuuuuuooooooo…….uuuuuuutttttssssssslllllllttttttteeeeeeetttttttoooooooeeeeeeecceeeeeeeE…….dddddddrrrrryyyyyyyttttttttttttttrrrrrrrfffffffrrrrrrrwwwwwwwvvvvvvvvvvvvvvpppppppeeeeehheeeeeeeaaaaaaarrrrrrrttttttthhhhhhhpppppppaaaaaaacccccccLiiiiiiieeeeeeeeeeeeeeuuuuuuuooooooo…..nnnnnnndddddddssssssseeeeeeeaaiiiiiiiaaaaaaammmmmmmpppppppeeeeeeePpppppppnnnnnnnnnnnnnncccccccooooooosssssss…….sssssssssiiiiiiitttttttpppppppeeeeeeettttttttttttttsssssssoooooooeeeeeeeaaaaaaallllllliiiiiiieehhhhhhh(iiiiiiicccccccaaaaaaaiiiiiiiaaaaaaassssssscccccccvvvvvvvgggggggoooooooooooooobbbbbbb4ooooooooooooooeeeeeeetttttttrrrrrrreeeeeeeeeeeeeeeeeeeeennnnnnnwwcccccccfffffffllllllliiiiiii3vvvvvvvtttttttooooooooooooooeeeeeeennnnnnnoooooooooooooossssssssssssssaaaaaaaoooooooeeeeeeettttttt5iilllllllnnnnnnnllooooooovvvvvvveeeeeeehhhhhhhnnnnnnndddddddnnnnnnnfffffffwwwwwwwooooooollccccccc7eeeeeeedddddddllllllleeeeeeeyyyyyyyaaaaaaalllllllsssssssnncccccccfffffff…….)eeeeeeeaaaaaaaiiiiiiinnnnnnnwwwwwwwmmmmmmmllllllltttttttoooyyyyyyyooooooeeeeeeesssssssoooooooaaaaaaaggggggghhhhhhhuuuuuuuiiiiiiioooooooiiiiiiixxxxxxxfffffffttnnnnnnnaaaaaaatttttttaaaaaaannnntttttttiiiiiiifffffffrrrrrrrhhhhhhhcccccccnnnnnnnuuuuuuuccccccciiiiiiippeeeeeeeggggggg…….tttttttfffffffnnnnnnneeeeeeehhhhhhhrrrrrrreeeeeeeeeeeeeeaaaaaaarrrrrrrUUUUUUUrr(((((((tttttttssssssssssssssooeeeeeeerrrrrrraaaaaaahhhhhhhcccccccooooooonnnnnnnsssssssttttttt,,,,,,,iiiiiiieeeeeee…….vvnnnnnnniiiiiiivvvvvvvoooooooooooooogggggggpppppppssssssssssssssiieeeeeeedddddddrrrrrrr…….ddlllllll,,,,,,,uuuuuuunnnnnnneeggggggg…….
If you have any further problems with your product, please call your Authorised Service Centre. If you have any further problems with your product, please call your Authorised Service Centre.

amount to a major failure. The benefits to you

111144441251 14

Service:

1300 11 HELP (4357)

NTroatnesportation TRANSPORTATION
(b) the Appliance is modified without authority from Keep the original carton of the product and use this packaging if the item needs to be transported. Follow the transport signs on the carton. Place a paper between the upper cover and cooking panel, cover tinhethueppfiersr tcowveeer,ktahaftnertappuerctohathse swidilel nsuortfpacroevs ide of oven. Tape cardboard or paper onto the inside face of the glass as it will be susceptible to damage from the trays. Use cardboard covers for the wire grill and trays in your oven. Also tape the oven’s covers to the side walls. If the original carton is unavailable, take measures to protect the external surfaces (glass and painted surfaces) of oven against possible blows, as well as the above.

amount to a major failure. The benefits to you

Service:

1300 11 HELP (4357)

151261

NCotoeksing Guides
COOKING GUIDES
(b) the Appliance is modified without authority from

For optimum cooking keep edges of baking dishes and pans at least 4cm from the sides of the oven. This

allows free heat circulation and ensures even cooking. Where possible remove large cuts of meat 1kg or over

froimn

tthhee

ffirrisdtgew1eehkouarftperrioprutrochcoaoskeinwgi.llAnllootwp,rtoovide

stand covered and away from direct sun/heat. This process will take the “chill” of the fridge away from the

food and assist in more even cooking.

Oven Shelf Location

Your Omega oven has five positions or racks for the oven shelves to be positioned depending on your choice of cooking function and size of roasting dishes or containers. These are numbered from 1 (the lowest shelf position) to 5 (the highest shelf position). See diagram in oven manual. To obtain maximum space above and below the shelves, it is recommended that you position trays and dishes in the following way:

When using only 1 shelf, use position/rack 2 or 3 (That’s oven shelf position).

When using 2 shelves, use position/rack 2 and 4.

Roasting Meat, Cooking Chicken and Fish

· Ideally, meat should be at least 1Kg or more when roasting in order to prevent it from drying out. · When cooking white meat, poultry and fish, use temperature settings (180°C-220°C). · For red meat that should be well done on the outside while tender and juicy on the inside, it is a good idea
to start with a high temperature setting (200°C-220°C) for a short timSee, rtvhiecne:turn th1e3o0v0en11doHwEnLPaft(e4r3w5a7r)ds and finish off. ·amWouhnent tloaragemr acjuotrsfoafilumreea. tT, hpeoubletrnyeofirtsfistoh yhoauve finished cooking, ideally remove the food from oven and cover with foil and stand for 10-20 minutes (depending on size). This will help retain the juices when the meat is carved.
· When cooking large whole fish 1kg or large it is recommended that the flesh be scored or slashed 2- 3 times on either side to assist in more even cooking. To do this cut into the thick fish flesh behind the head through to the bone. These scored areas also allow you to check easily to see if the fish is cooked.
· It is a good idea to either measure the inside of your oven for width and either write this down in book you may have with you when shopping or you can cut a piece of string the oven width this makes it easier to know if your fish will fit into the oven. Looks can be deceiving and the fish looks so much better whole with its head and tail. If it doesn’t fit you will probably need to remove the head prior to baking.

161271

NCotoeksing Guides

(b) the Appliance is modified without authority from
Grilling Cooking times may vary according to the nature of the foods, theiirnhtohmeofigresnt ewiteyeaknadfttehreipruvroclhuamsee. Wwihllennoctoporkoivnigde a certain food for the first time, it is advisable to choose the lowest temperature and then increase temperature as required.
Cakes and Baking
Organize the oven shelves while the oven is cold and before preparing a recipe. When baking follow the directions in the recipe however if in doubt as a general rule the food (e.g. cake) is positioned on a shelf that will have the top of the cake surface as near to the centre of the oven as possible.
· Preheat oven before preparing the cake or baked items as some baked food does not like to sit waiting for the oven to reach the required temperature. For best results the baked food should go straight into the preheat oven at the correct temperature.
· Use kitchen baking paper to line cake tins and baking trays for cookies and roast vegetables such as pumpkin.
· When making cakes have eggs at room temperature. · When making sponge cakes don’t tap the beaters on the side of the bowl when the beating is complete
as this will knock out precious air you have just spent time adding. Remove the beaters from the hand mixer and tap them over the edge of your open palm to knock any remaining cake mix into the bowl below.

Pavlova and Meringues

Service:

1300 11 HELP (4357)

· Eggs should be at room temperature.
· amEonusunrtetothaatmthaejobrofawiluarned. Tbehaetebresnteofbites utoseydoaure super clean and have no grease, oil or fat on them as this will retard the beating and peak forming process.
· It is a good idea to crack the eggs to be used one at a time over a small bowl to separate the egg yolks and whites that way if a yolk does break it will not end up in your main bowl of egg whites.
· When making pavlova or meringues don’t tap the beaters on the side of the bowl when the beating is complete as this will knock out precious air you have just spent time adding. Remove the beaters from the hand mixer and tap them over the edge of your open palm to knock any remaining mix into the bowl below.
· Line baking trays with kitchen baking paper. · When they are cooked, remove the tray from the oven and use a very flat spatula to loosen the food from
the baking paper. Return the Pavlova or meringues to the oven and allow to stand overnight or until the oven is cold for best results. Think about using the remaining egg yolks to make homemade mayonnaise.

1281 17

Notes
(b) the Appliance is modified without authority from

in the first week after purchase will not provide

amount to a major failure. The benefits to you

Service:

1300 11 HELP (4357)

1291

Notes
(b) the Appliance is modified without authority from

in the first week after purchase will not provide

amount to a major failure. The benefits to you

Service:

1300 11 HELP (4357)

2201

Notes
(b) the Appliance is modified without authority from

in the first week after purchase will not provide

amount to a major failure. The benefits to you

Service:

1300 11 HELP (4357)

2211

Warranty

WARRANTY TERMS AND CONDITIONS

3. During the Warranty Period Residentia Group or

COOVEONKSTOPS

its ASR will, at no extra charge if your Appliance

is readily accessible for service, without special

This document sets out the terms and conditions

equipment and subject to these terms and

of the product warranties for Residentia Group

conditions, repair or replace any parts which it

Appliances. It is an important document. Please keep

considers to be defective. Residentia Group or

it with your proof of purchase documents in a safe

its ASR may use remanufactured parts to repair

place for future reference should you require service

your Appliance. You agree that any replaced

for your Appliance.

Appliances or parts become the property of

Residentia Group. This warranty does not apply

1. IN THIS WARRANTY (a) `acceptable quality’ as referred to in clause 10 of

to light globes, batteries, filters, seals or similar perishable parts.

this warranty has the same meaning referred to

in the ACL;

4. Parts and Appliances not supplied by Residentia

(b) `ACL’ means Trade Practices Amendment

Group are not covered by this warranty.

(Australian Consumer Law) Act (No.2) 2010;

5. You will bear the cost of transportation, travel

product purchased by you accompanied by this

and delivery of the Appliance to and from

document;

Residentia Group or its ASR. If you reside

(d) `ASR’ means Residentia Group authorised

outside of the service area, you will bear the

service representative;

cost of:

(e) `Residentia Group’ means Residentia Group Pty (a) travel of an authorised representative;

Ltd of 165 Barkly Ave, Burnley VIC 3121, ACN (b) transportation and delivery of the Appliance to

600 546 656 in respect of Appliances purchased

and from Residentia Group or its ASR, in all

in Australia;

instances, unless the Appliance is transported

(f ) `major failure’ as referred to in clause 10 of

by Residentia Group or its ASR, the Appliance is

this warranty has the same meaning referred

transported at the owner’s cost and risk while in

to in the ACL and includes a situation when

transit to and from Residentia Group or its ASR.

an Appliance cannot be repaired or it is

uneconomic for Residentia Group, at its

6. Proof of purchase is required before you can

discretion, to repair an Appliance during the

make a claim under this warranty.

Warranty Period;

(g) `Warranty Period’ means: (i) where the Appliance is used for personal, domestic or household use (i.e. normal

7. You may not make a claim under this warranty unless the defect claimed is due to faulty or defective parts or workmanship. Residentia

single family use) as set out in the

Group is not liable in the following situations

instruction manual, the Appliance is

(which are not exhaustive):

warranted against manufacturing defects (a) the Appliance is damaged by:

for 24 months, following the date of original

(i) accident

purchase of the Appliance;

(ii) misuse or abuse, including failure to

(h) `you’ means the purchaser of the Appliance not having purchased the Appliance for re-sale, and `your’ has a corresponding meaning.

properly maintain or service (iii) normal wear and tear (iv) power surges, electrical storm damage or

incorrect power supply

2. This warranty only applies to Appliances

(v) incomplete or improper installation

purchased and used in Australia and is in

(vi) incorrect, improper or inappropriate

addition to (and does

operation

not exclude, restrict, or modify in any way) any

(vii) insect or vermin infestation

non-excludable statutory warranties in Australia.

(viii) failure to comply with any additional

instructions supplied with the Appliance;

— THIS WARRANTY IS VALID IN AUSTRALIA ONLY —

Warranty

(b) the Appliance is modified without authority from Residentia Group in writing;
(c) the Appliance’s serial number or warranty seal has been removed or defaced;
(d) the Appliance was serviced or repaired by anyone other than Residentia Group, an authorised repairer or ASR.
8. This warranty, the contract to which it relates and the relationship between you and Residentia Group are governed by the law applicable where the Appliance was purchased.
9. To the extent permitted by law, Residentia Group excludes all warranties and liabilities (other than as contained in this document) including liability for any loss or damage whether direct or indirect arising from your purchase, use or non use of the Appliance.
10. For Appliances and services provided by Residentia Group in Australia, the Appliances come with a guarantee by Residentia Group that cannot be excluded under the Australian Consumer Law. You are entitled to a replacement or refund for a major failure and for compensation for any other reasonably foreseeable loss or damage. You are also entitled to have the Appliance repaired or replaced if the Appliance fails to be of acceptable quality and the failure does not amount to a major failure. The benefits to you given by this warranty are in addition to your other rights and remedies under a law in relation to the Appliances or services to which the warranty relates.

12. Missing parts are not covered by warranty. Residentia Group reserves the right to assess each request for missing parts in a case by case basis. Any parts that are not reported missing in the first week after purchase will not provide free of charge.

13. To enquire about claiming under this warranty, please follow these steps:
(a) carefully check the operating instructions, user manual and the terms of this warranty;
(b) have the model and serial number of the Appliance available;
(c) have the proof of purchase (e.g. an invoice) available;
(d) telephone the numbers shown below.

14. You accept that if you make a warranty claim, Residentia Group and its ASR may exchange information in relation to you to enable Residentia Group to meet its obligations under this warranty.

IMPORTANT Before calling for service, please ensure that the steps in point 13 have been followed.

CONTACT SERVICE

Service:

1300 11 HELP (4357)

11. At all times during the Warranty Period, Residentia Group shall, at its discretion, determine whether repair, replacement or refund will apply if an Appliance has a valid warranty claim applicable to it.

The Australian Consumer Law requires the inclusion of the following statement with this warranty:

Our goods come with guarantees that cannot be excluded under the Australian Consumer Law. You are entitled to a replacement or refund for a major failure and for compensation for any other reasonably foreseeable loss or damage. You are also entitled to have the goods repaired or replaced if the goods fail to be of acceptable quality and the failure does not amount to a major failure.

— THIS WARRANTY IS VALID IN AUSTRALIA ONLY —

2231

NTiotltees
(b) the Appliance is modified without authority from

in the first week after purchase will not provide

amount to a major failure. The benefits to you

Service:

1300 11 HELP (4357)

1 2241